Review



unmethylated 236 human control dna  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Zymo Research unmethylated 236 human control dna
    Unmethylated 236 Human Control Dna, supplied by Zymo Research, used in various techniques. Bioz Stars score: 94/100, based on 243 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+control+dna/Human+Methylated+%26+Non-Methylated+(WGA)+DNA+Set+(DNA+w%2F+primers)/pm41985722-118-14-19
    Average 94 stars, based on 243 article reviews
    unmethylated 236 human control dna - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Control:

    Article Title: Divergent phenotypes of human regulatory T cells expressing the receptors TIGIT and CD226
    Article Snippet: .. DNA standards originated from unmethylated bisulfite-converted human EpiTect control DNA (Qiagen) or universally methylated bisulfite-converted human control DNA (Zymo Research). .. To obtain a large quantity of standard, the TSDR was PCR amplified using the following reaction: 50 μL reaction volume containing 25 μL of ZymoTaq TM PreMix buffer (Zymo Research) and 0.5 μM each of the primers FOXP3_TSDRfwd (ATATTTTTAGATAGGGATATGGAGATGATTTGTTTGG) and FOXP3_TSDRrev (AATAAACATCACCTACCACATCCACCAACAC).

    Article Title: Ex vivo generation of γδ Foxp3
    Article Snippet: Bisulfite treatment of genomic DNA was performed on 500 ng DNA with the EZ DNA Methylation Kit (Zymo Research). .. DNA standards originated from unmethylated bisulfite-converted human EpiTect control DNA (Qiagen) or universally methylated bisulfite-converted human control DNA (Zymo Research). .. To obtain a large quantity of standard, the TSDR was PCR-amplified using the following reaction: 50 μl reaction volume containing 25 μl of ZymoTaq PreMix buffer (Zymo Research) and 0.5 μM each of the primers FOXP3_TSDRfwd (5′-ATATTTTTAGATAGGGATATGGAGATGATTTGTTTGG-3′ SEQ ID NO: 1) and FOXP3_TSDRrev (5′-AATAAACATCACCTACCACATCCACCAACAC-3′-SEQ ID NO: 2).

    Article Title: Regulatory T-cells, method for their isolation and uses
    Article Snippet: .. DNA was comprised of unmethylated bisulfite-converted human EpiTect control DNA (Qiagen) and universally methylated bisulfite-converted human control DNA (Zymo Research). .. The TSDR was PCR amplified using the following reaction: 50 μL reaction volume containing 25 μL of ZymoTaqTM PreMix buffer (Zymo Research) and 0.5 μM each of the primers FOXP3_TSDRfwd (ATATTTTTAGATAGGGATATGGAGATGATTTGTTTGG) (SEQ ID NO: 2) and FOXP3_TSDRrev (AATAAACATCACCTACCACATCCACCAACAC) (SEQ ID NO: 3).

    Article Title: Ex vivo generation of MHCII restricted CD4
    Article Snippet: Bisulfite treatment of genomic DNA was performed on 500 ng DNA with the EZ DNA Methylation Kit (Zymo Research). .. DNA standards originated from unmethylated bisulfite-converted human EpiTect control DNA (Qiagen) or universally methylated bisulfite-converted human control DNA (Zymo Research). .. To obtain a large quantity of standard, the TSDR was PCR-amplified using the following reaction: 50 μl reaction volume containing 25 μl of ZymoTaq PreMix buffer (Zymo Research) and 0.5 μM each of the primers FOXP3_TSDRfwd (5′-ATATTTTTAGATAGGGATATGGAGATGATTTGTTTGG-3′ SEQ ID NO: 1) and FOXP3_TSDRrev (5′-AATAAACATCACCTACCACATCCACCAACAC-3′-SEQ ID NO: 2).

    Article Title: Divergent Phenotypes of Human Regulatory T Cells Expressing the Receptors TIGIT and CD226.
    Article Snippet: .. DNA standards originated from unmethylated bisulfite-converted human EpiTect control DNA (Qiagen) or universally methylated bisulfite-converted human control DNA (Zymo Research). .. To obtain a large quantity of standard, we PCR-amplified the TSDR using the following reaction: 50 ml reaction volume containing 25 ml of ZymoTaq PreMix buffer (Zymo Research) and 0.5 mM each of the primers FOXP3_TSDRfwd (59-ATATTTTTAGATAGGGATATGGAGATGATTTGTTTGG-39) and FOXP3_TSDRrev (59-AATAAACATCACCTACCACATCCACCAACAC-39).

    Methylation:

    Article Title: Divergent phenotypes of human regulatory T cells expressing the receptors TIGIT and CD226
    Article Snippet: .. DNA standards originated from unmethylated bisulfite-converted human EpiTect control DNA (Qiagen) or universally methylated bisulfite-converted human control DNA (Zymo Research). .. To obtain a large quantity of standard, the TSDR was PCR amplified using the following reaction: 50 μL reaction volume containing 25 μL of ZymoTaq TM PreMix buffer (Zymo Research) and 0.5 μM each of the primers FOXP3_TSDRfwd (ATATTTTTAGATAGGGATATGGAGATGATTTGTTTGG) and FOXP3_TSDRrev (AATAAACATCACCTACCACATCCACCAACAC).

    Article Title: Ex vivo generation of γδ Foxp3
    Article Snippet: Bisulfite treatment of genomic DNA was performed on 500 ng DNA with the EZ DNA Methylation Kit (Zymo Research). .. DNA standards originated from unmethylated bisulfite-converted human EpiTect control DNA (Qiagen) or universally methylated bisulfite-converted human control DNA (Zymo Research). .. To obtain a large quantity of standard, the TSDR was PCR-amplified using the following reaction: 50 μl reaction volume containing 25 μl of ZymoTaq PreMix buffer (Zymo Research) and 0.5 μM each of the primers FOXP3_TSDRfwd (5′-ATATTTTTAGATAGGGATATGGAGATGATTTGTTTGG-3′ SEQ ID NO: 1) and FOXP3_TSDRrev (5′-AATAAACATCACCTACCACATCCACCAACAC-3′-SEQ ID NO: 2).

    Article Title: Regulatory T-cells, method for their isolation and uses
    Article Snippet: .. DNA was comprised of unmethylated bisulfite-converted human EpiTect control DNA (Qiagen) and universally methylated bisulfite-converted human control DNA (Zymo Research). .. The TSDR was PCR amplified using the following reaction: 50 μL reaction volume containing 25 μL of ZymoTaqTM PreMix buffer (Zymo Research) and 0.5 μM each of the primers FOXP3_TSDRfwd (ATATTTTTAGATAGGGATATGGAGATGATTTGTTTGG) (SEQ ID NO: 2) and FOXP3_TSDRrev (AATAAACATCACCTACCACATCCACCAACAC) (SEQ ID NO: 3).

    Article Title: Ex vivo generation of MHCII restricted CD4
    Article Snippet: Bisulfite treatment of genomic DNA was performed on 500 ng DNA with the EZ DNA Methylation Kit (Zymo Research). .. DNA standards originated from unmethylated bisulfite-converted human EpiTect control DNA (Qiagen) or universally methylated bisulfite-converted human control DNA (Zymo Research). .. To obtain a large quantity of standard, the TSDR was PCR-amplified using the following reaction: 50 μl reaction volume containing 25 μl of ZymoTaq PreMix buffer (Zymo Research) and 0.5 μM each of the primers FOXP3_TSDRfwd (5′-ATATTTTTAGATAGGGATATGGAGATGATTTGTTTGG-3′ SEQ ID NO: 1) and FOXP3_TSDRrev (5′-AATAAACATCACCTACCACATCCACCAACAC-3′-SEQ ID NO: 2).

    Article Title: Divergent Phenotypes of Human Regulatory T Cells Expressing the Receptors TIGIT and CD226.
    Article Snippet: .. DNA standards originated from unmethylated bisulfite-converted human EpiTect control DNA (Qiagen) or universally methylated bisulfite-converted human control DNA (Zymo Research). .. To obtain a large quantity of standard, we PCR-amplified the TSDR using the following reaction: 50 ml reaction volume containing 25 ml of ZymoTaq PreMix buffer (Zymo Research) and 0.5 mM each of the primers FOXP3_TSDRfwd (59-ATATTTTTAGATAGGGATATGGAGATGATTTGTTTGG-39) and FOXP3_TSDRrev (59-AATAAACATCACCTACCACATCCACCAACAC-39).



    Similar Products

    94
    Zymo Research unmethylated 236 human control dna
    Unmethylated 236 Human Control Dna, supplied by Zymo Research, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+control+dna/Human+Methylated+%26+Non-Methylated+(WGA)+DNA+Set+(DNA+w%2F+primers)/pm41985722-118-14-19
    Average 94 stars, based on 1 article reviews
    unmethylated 236 human control dna - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Twist Bioscience human bocavirus 1
    Human Bocavirus 1, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+control+dna/Twist+Synthetic+Human+bocavirus+1+DNA+control/pm41736006-67-20-23
    Average 94 stars, based on 1 article reviews
    human bocavirus 1 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    OriGene human gfp cdna
    Human Gfp Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+control+dna/Female+Human+Forensic+Control+DNA/us12606846-239-1-8
    Average 90 stars, based on 1 article reviews
    human gfp cdna - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    95
    Zymo Research negative control
    Negative Control, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+control+dna/Human+HCT116+DKO+Non-Methylated+DNA/pmc13014933-54-15-22
    Average 95 stars, based on 1 article reviews
    negative control - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    96
    Zymo Research vitro methylated human dna
    Identification and Validation of Heart-Specific <t>Methylated</t> CpG Sites in PIH1D1 (A) Workflow illustrating the selection criteria for heart-specific methylated CpG sites (HSMCs). CpG sites were filtered by comparing methylation levels in the left atrium to those in 24 other tissues. Sites with methylation levels below 10% in noncardiac tissues were first selected. CpG sites showing a methylation difference >10% between the left atrium and the average of other tissues were further classified as HSMCs. (B) A total of 33 CpG sites met these criteria and were classified as HSMCs. Heatmap showing the methylation β-values of these 33 HSMCs across 25 different human tissues. (C) Scatter plot showing the β-values of the left atrium (x-axis) compared with the average β-values of 24 other tissues (y-axis) with SD error bars. The orange dot highlights PIH1D1 , representing a CpG site of interest for further investigation. (D) <t>DNA</t> methylation β-values of PIH1D1 (cg02184280) across The Cancer Genome Atlas (TCGA) and The Genomic Data Commons (GDC) data sets, including pan-cancer and breast cancer cohorts. β-values remain below 10% in primary tumors, adjacent normal tissues, and metastatic samples, with higher hypomethylation specificity observed in breast cancer patients. (E) Schematic representation highlighting the CpG site cg02184280 (purple) and the design of methylation-specific PCR (MSP) primers (red) and bisulfite pyrosequencing primers (orange). (F) Gel-based MSP shows amplicons in primary human cardiomyocytes (HCM), induced pluripotent stem cell–derived cardiomyocytes (iPSC-CMs), and AC16 cells but not in GES or breast cancer cell lines. Amplicons were also observed in doxorubicin-treated iPSC-CMs, indicating the specificity of the detected CpG sites to cardiac tissue methylation patterns. In vitro methylated human DNA (IVD) was used as a positive control to validate the specificity and efficiency of the methylation-specific primers. “M” indicates detection of methylated PIH1D1 , while a product in the “U” lane indicates unmethylated PIH1D1 .
    Vitro Methylated Human Dna, supplied by Zymo Research, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+control+dna/Positive+Control/pmc12995573-53-1-5
    Average 96 stars, based on 1 article reviews
    vitro methylated human dna - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Zymo Research control dna
    Identification and Validation of Heart-Specific <t>Methylated</t> CpG Sites in PIH1D1 (A) Workflow illustrating the selection criteria for heart-specific methylated CpG sites (HSMCs). CpG sites were filtered by comparing methylation levels in the left atrium to those in 24 other tissues. Sites with methylation levels below 10% in noncardiac tissues were first selected. CpG sites showing a methylation difference >10% between the left atrium and the average of other tissues were further classified as HSMCs. (B) A total of 33 CpG sites met these criteria and were classified as HSMCs. Heatmap showing the methylation β-values of these 33 HSMCs across 25 different human tissues. (C) Scatter plot showing the β-values of the left atrium (x-axis) compared with the average β-values of 24 other tissues (y-axis) with SD error bars. The orange dot highlights PIH1D1 , representing a CpG site of interest for further investigation. (D) <t>DNA</t> methylation β-values of PIH1D1 (cg02184280) across The Cancer Genome Atlas (TCGA) and The Genomic Data Commons (GDC) data sets, including pan-cancer and breast cancer cohorts. β-values remain below 10% in primary tumors, adjacent normal tissues, and metastatic samples, with higher hypomethylation specificity observed in breast cancer patients. (E) Schematic representation highlighting the CpG site cg02184280 (purple) and the design of methylation-specific PCR (MSP) primers (red) and bisulfite pyrosequencing primers (orange). (F) Gel-based MSP shows amplicons in primary human cardiomyocytes (HCM), induced pluripotent stem cell–derived cardiomyocytes (iPSC-CMs), and AC16 cells but not in GES or breast cancer cell lines. Amplicons were also observed in doxorubicin-treated iPSC-CMs, indicating the specificity of the detected CpG sites to cardiac tissue methylation patterns. In vitro methylated human DNA (IVD) was used as a positive control to validate the specificity and efficiency of the methylation-specific primers. “M” indicates detection of methylated PIH1D1 , while a product in the “U” lane indicates unmethylated PIH1D1 .
    Control Dna, supplied by Zymo Research, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+control+dna/Human+Brain+DNA/pm41946276-194-6-16
    Average 93 stars, based on 1 article reviews
    control dna - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    Zymo Research standard bisulfite converted universal methylated human dna standard
    Identification and Validation of Heart-Specific <t>Methylated</t> CpG Sites in PIH1D1 (A) Workflow illustrating the selection criteria for heart-specific methylated CpG sites (HSMCs). CpG sites were filtered by comparing methylation levels in the left atrium to those in 24 other tissues. Sites with methylation levels below 10% in noncardiac tissues were first selected. CpG sites showing a methylation difference >10% between the left atrium and the average of other tissues were further classified as HSMCs. (B) A total of 33 CpG sites met these criteria and were classified as HSMCs. Heatmap showing the methylation β-values of these 33 HSMCs across 25 different human tissues. (C) Scatter plot showing the β-values of the left atrium (x-axis) compared with the average β-values of 24 other tissues (y-axis) with SD error bars. The orange dot highlights PIH1D1 , representing a CpG site of interest for further investigation. (D) <t>DNA</t> methylation β-values of PIH1D1 (cg02184280) across The Cancer Genome Atlas (TCGA) and The Genomic Data Commons (GDC) data sets, including pan-cancer and breast cancer cohorts. β-values remain below 10% in primary tumors, adjacent normal tissues, and metastatic samples, with higher hypomethylation specificity observed in breast cancer patients. (E) Schematic representation highlighting the CpG site cg02184280 (purple) and the design of methylation-specific PCR (MSP) primers (red) and bisulfite pyrosequencing primers (orange). (F) Gel-based MSP shows amplicons in primary human cardiomyocytes (HCM), induced pluripotent stem cell–derived cardiomyocytes (iPSC-CMs), and AC16 cells but not in GES or breast cancer cell lines. Amplicons were also observed in doxorubicin-treated iPSC-CMs, indicating the specificity of the detected CpG sites to cardiac tissue methylation patterns. In vitro methylated human DNA (IVD) was used as a positive control to validate the specificity and efficiency of the methylation-specific primers. “M” indicates detection of methylated PIH1D1 , while a product in the “U” lane indicates unmethylated PIH1D1 .
    Standard Bisulfite Converted Universal Methylated Human Dna Standard, supplied by Zymo Research, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+control+dna/Positive+Control/pm41903599-78-0-7
    Average 96 stars, based on 1 article reviews
    standard bisulfite converted universal methylated human dna standard - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    Zymo Research universal human methylated control dna
    Identification and Validation of Heart-Specific <t>Methylated</t> CpG Sites in PIH1D1 (A) Workflow illustrating the selection criteria for heart-specific methylated CpG sites (HSMCs). CpG sites were filtered by comparing methylation levels in the left atrium to those in 24 other tissues. Sites with methylation levels below 10% in noncardiac tissues were first selected. CpG sites showing a methylation difference >10% between the left atrium and the average of other tissues were further classified as HSMCs. (B) A total of 33 CpG sites met these criteria and were classified as HSMCs. Heatmap showing the methylation β-values of these 33 HSMCs across 25 different human tissues. (C) Scatter plot showing the β-values of the left atrium (x-axis) compared with the average β-values of 24 other tissues (y-axis) with SD error bars. The orange dot highlights PIH1D1 , representing a CpG site of interest for further investigation. (D) <t>DNA</t> methylation β-values of PIH1D1 (cg02184280) across The Cancer Genome Atlas (TCGA) and The Genomic Data Commons (GDC) data sets, including pan-cancer and breast cancer cohorts. β-values remain below 10% in primary tumors, adjacent normal tissues, and metastatic samples, with higher hypomethylation specificity observed in breast cancer patients. (E) Schematic representation highlighting the CpG site cg02184280 (purple) and the design of methylation-specific PCR (MSP) primers (red) and bisulfite pyrosequencing primers (orange). (F) Gel-based MSP shows amplicons in primary human cardiomyocytes (HCM), induced pluripotent stem cell–derived cardiomyocytes (iPSC-CMs), and AC16 cells but not in GES or breast cancer cell lines. Amplicons were also observed in doxorubicin-treated iPSC-CMs, indicating the specificity of the detected CpG sites to cardiac tissue methylation patterns. In vitro methylated human DNA (IVD) was used as a positive control to validate the specificity and efficiency of the methylation-specific primers. “M” indicates detection of methylated PIH1D1 , while a product in the “U” lane indicates unmethylated PIH1D1 .
    Universal Human Methylated Control Dna, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+control+dna/Universal+Methylated+Human+DNA+Standard/pmc13024877-92-3-8
    Average 95 stars, based on 1 article reviews
    universal human methylated control dna - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results


    Identification and Validation of Heart-Specific Methylated CpG Sites in PIH1D1 (A) Workflow illustrating the selection criteria for heart-specific methylated CpG sites (HSMCs). CpG sites were filtered by comparing methylation levels in the left atrium to those in 24 other tissues. Sites with methylation levels below 10% in noncardiac tissues were first selected. CpG sites showing a methylation difference >10% between the left atrium and the average of other tissues were further classified as HSMCs. (B) A total of 33 CpG sites met these criteria and were classified as HSMCs. Heatmap showing the methylation β-values of these 33 HSMCs across 25 different human tissues. (C) Scatter plot showing the β-values of the left atrium (x-axis) compared with the average β-values of 24 other tissues (y-axis) with SD error bars. The orange dot highlights PIH1D1 , representing a CpG site of interest for further investigation. (D) DNA methylation β-values of PIH1D1 (cg02184280) across The Cancer Genome Atlas (TCGA) and The Genomic Data Commons (GDC) data sets, including pan-cancer and breast cancer cohorts. β-values remain below 10% in primary tumors, adjacent normal tissues, and metastatic samples, with higher hypomethylation specificity observed in breast cancer patients. (E) Schematic representation highlighting the CpG site cg02184280 (purple) and the design of methylation-specific PCR (MSP) primers (red) and bisulfite pyrosequencing primers (orange). (F) Gel-based MSP shows amplicons in primary human cardiomyocytes (HCM), induced pluripotent stem cell–derived cardiomyocytes (iPSC-CMs), and AC16 cells but not in GES or breast cancer cell lines. Amplicons were also observed in doxorubicin-treated iPSC-CMs, indicating the specificity of the detected CpG sites to cardiac tissue methylation patterns. In vitro methylated human DNA (IVD) was used as a positive control to validate the specificity and efficiency of the methylation-specific primers. “M” indicates detection of methylated PIH1D1 , while a product in the “U” lane indicates unmethylated PIH1D1 .

    Journal: JACC: Basic to Translational Science

    Article Title: Methylated PIH1D1 as a Heart-Specific Biomarker for Anthracycline-Induced Cardiac Remodeling in Breast Cancer Patients

    doi: 10.1016/j.jacbts.2026.101510

    Figure Lengend Snippet: Identification and Validation of Heart-Specific Methylated CpG Sites in PIH1D1 (A) Workflow illustrating the selection criteria for heart-specific methylated CpG sites (HSMCs). CpG sites were filtered by comparing methylation levels in the left atrium to those in 24 other tissues. Sites with methylation levels below 10% in noncardiac tissues were first selected. CpG sites showing a methylation difference >10% between the left atrium and the average of other tissues were further classified as HSMCs. (B) A total of 33 CpG sites met these criteria and were classified as HSMCs. Heatmap showing the methylation β-values of these 33 HSMCs across 25 different human tissues. (C) Scatter plot showing the β-values of the left atrium (x-axis) compared with the average β-values of 24 other tissues (y-axis) with SD error bars. The orange dot highlights PIH1D1 , representing a CpG site of interest for further investigation. (D) DNA methylation β-values of PIH1D1 (cg02184280) across The Cancer Genome Atlas (TCGA) and The Genomic Data Commons (GDC) data sets, including pan-cancer and breast cancer cohorts. β-values remain below 10% in primary tumors, adjacent normal tissues, and metastatic samples, with higher hypomethylation specificity observed in breast cancer patients. (E) Schematic representation highlighting the CpG site cg02184280 (purple) and the design of methylation-specific PCR (MSP) primers (red) and bisulfite pyrosequencing primers (orange). (F) Gel-based MSP shows amplicons in primary human cardiomyocytes (HCM), induced pluripotent stem cell–derived cardiomyocytes (iPSC-CMs), and AC16 cells but not in GES or breast cancer cell lines. Amplicons were also observed in doxorubicin-treated iPSC-CMs, indicating the specificity of the detected CpG sites to cardiac tissue methylation patterns. In vitro methylated human DNA (IVD) was used as a positive control to validate the specificity and efficiency of the methylation-specific primers. “M” indicates detection of methylated PIH1D1 , while a product in the “U” lane indicates unmethylated PIH1D1 .

    Article Snippet: In vitro methylated human DNA (ZYMO) was used as a positive control for methylation.

    Techniques: Biomarker Discovery, Methylation, Selection, DNA Methylation Assay, Derivative Assay, In Vitro, Positive Control